Căutare
  • Căutare
  • Povestirile Mele

Protein Synthesis Project

Creați un Storyboard
Copiați acest Storyboard
Protein Synthesis Project
Storyboard That

Creează-ți propriul Storyboard

Încercați-l gratuit!

Creează-ți propriul Storyboard

Încercați-l gratuit!

Storyboard Text

  • What is protein synthesis?
  • 
  • 
  • 
  • 
  • 
  • Protein Synthesis...
  • Well, protein synthesis is the cell’s process of making proteins. These proteins are made to be used for different cell processes, to help the cell function just like how gas helps a car function. These proteins are built of amino acids.
  •     
  • The first step of protein synthesis is transcription. Transcription is when RNA is coded from a template strand of DNA. This mRNA is used in many forms for messaging information. How this works is there will be a sequence of letters in DNA representing different amino acids. Through transcription, these letters will be coded into different letters for mRNA while still keeping the same instructions. Three letters/ bases represents a codon.
  • 
  • Protein Synthesis:Transcription
  • DNA:  TACGGCAATCTGGCAATCGCCTGGACTGmRNA: AUGCCGUUAGACCGUUAGCGGACCUGACComplementary strand
  • 
  • 
  • DNA: A, T, C, GRNA: U, T, G, C
  • How does transcription benefit an organism.
  • 
  • 
  • 
  • 
  • Protein Synthesis...
  • Transcription allows certain genes to be turned on or off. This allows the following process to work properly and result in the proper genes. This whole process determines what an organism will look like and how it will function.
  •     
  • 
  • Protein Synthesis:Translation
  • The next step in protein synthesis is translation. During this step, mRNA is read by the tRNA molecule and made into a protein in the ribosome.
  • Anticodon
  • tRNA
  • Codon
  • What does that mean.?
  • Well, tRNA is the bookworm. It reads the mRNA code by attaching to a codon using its anticodon which is the complementary set of bases to the codon. tRNA can only read one codon at a time. There are multiple tRNA molecules so this process works efficiently.
  • Ribosomes
  • 
  • Protein Synthesis:Translation
  •   After tRNA reads the information it takes it to the ribosomes. In the ribosomes, the coding information is actually processed and the proteins are finally made.
  • tRNA
  •     
  • 
  • Let’s review! Transcription happens so that the information carried in DNA can be turned to RNA in order for it to be used for coding. Translation happens so that mRNA can be turned into chains of amino acids that eventually will be folded into fully formed proteins. These processes occur so all the necessary proteins are produced for a cell.
  • Protein Synthesis:Complete process
Peste 30 de milioane de Storyboard-uri create